EST 1831849 is a singleton


Sequence

>1831849 (1 EST) Length=484 CGTGACGTGAGTGCGGATGCTCAGAAGGTGAAGTCATTGCTTCAACAGCTGGAAATCACGAGTCGCGGTGCTCATGTCAC GCCCCTTGGCGGAGGCACACCGAATGACCCAGGATCTACCACCGGCACACGTCTTAGCAGAGGGGTCGGGTCGAAAAGTT CACTGCGACTCTCCATGGGAGAAGACAGCAAAAATTAACAACAAAAAATAACAATAATAAAAAATAATAATAAAAGAAAA ATTGCAATGCAGGAAGAAAACTTTATGTATTTTTTCTTGTGAGGATTTTTATCTCTTTCTCTTTCTCTTTGTGTGTGTGT GTGTGTGTGTGTGTGTCTTATTGGGGAGGCGGGCGGTACGGTGGAGAAATGACGCATTTGTGTTTGTTTTTTTCCCTCCC CTTGCATTTTTGTTCTTGCCGTTATCCTCATGGATGAAGACAAATATATATATTAGATGCATGAAGTGAATTTGGGGGTT TGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1831849: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318493411383AI077075TENU3222T. cruzi epimastigote normalized cDNA Library


Date: 9:56:42 on Fri 24 Nov 117.