EST 1831851 is a singleton


Sequence

>1831851 (1 EST) Length=440 GTTGATCAGTGGATAGAAAAGTGCCCCGTGTACGATGAACACTTGACAGCCGCCTTGCAGAAGTTTCGTGCCCATTACGT GCAAAAGGTTGCAGAAGACTCTGATGTGTTTCAAGCTTTATACAATGAGTGCCATGAATCGATGGAGAAGGAATTGAATC GCATCGTGGAGTTGCGCAATGCGGTGGTGCAGCAGCAGTTACGTTGCATCGAGGGGATTATGGAGCAGCTGAAGGAGGGC AAGATGGCGGAGAACAAGACATTCCGGCTTTTGAAGTATTATCCTGCGAATGATGTCATGCGATTTCGCCCGTATGGAAA AGTGAGCGGCATTTCAGAAATGGGTGAGAGCGCGGACGTGTGCGAGCCGCCAGCGCCTGTTCTTGTTAACCCCTTCAATA CCGCACATTCCGCCAATTCTCCGTGACGCGGCAACACAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1831851: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318513411385AI077077TENU3224T. cruzi epimastigote normalized cDNA Library


Date: 4:39:49 on Sat 25 Nov 117.