EST 1831856 is a singleton


Sequence

>1831856 (1 EST) Length=564 CGTGCTGCTGTTTACGCGTCAAAGCTGCATAACGTTGACAAGGCAATTGTAGACCTCTCATTGTTGTTGAGCCTGCCCGG AAATGACTCCTGCACAGCTATGGCGTACTTGCAGCGCGCCAAGGCGTTTGAACAACGCAGTTGTGAACGCCCACGGACTT CGAGGGAGGACGTTGGGGCCGCTCTACGTGACTACAACAGTTTTGTGGAGACGGCGTTGATGCATCCACACGAACTAGAC GTCCCACCCGAGTGTATTACGGTGGCCATGCTAATCCTCGCGAACGGGGCGTTTAAGGAAAAAAACTACGGCCGGGCCGC ACGTTTTTTCGCACGTGCCGTCGCGAGAGGTTGGCGACCCCTTGAAGATTTACCGCGGGAACGCCGAGAAAAGAAGAAAA ATGTGTCGTCGATATCGCTTACGGGGGTGGATCTTCTCACAAAGATGTATTTGGCGATTGCCGCACTGTGGTGTCGAAGA TTCCTATTGCAGAGGACATGTTTAGGGTGCCGTACGAGCAGCGAGAAAAGCCCCCTGCGCAGGTGGTCACCGAGTTGAAG AAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1831856: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318563411390AI077082TENU3229T. cruzi epimastigote normalized cDNA Library


Date: 3:52:35 on Sun 19 Nov 117.