EST 1831865 is a singleton


Sequence

>1831865 (1 EST) Length=493 TATATGCTTTGTGTGACATGGCAGGAGTAGTACGGCTGTGTTGCACGTGGACGGTGATTTGACCATGGTTTCTATGAAGG AGTATATCCACCTTATTGGTGACTCCGTTAATGATGCTGACACCGCCAGTTAGCCGAGGAGGCTGTCAATGCGCCCTCAC TTTTTTTTTATGGATCTCTTTTTGAGCTTCATTCGGTGCAGAAGCTCCGTAGCAATCCTTCTTTTGCCTGGATCCCACAG CTGATGGAGATCCTTTGCTACGGGATGGTGGATGAACTCCATCTTCTTCCTGGCAGTGCAAAGAAGCATTTGACGCCATG TGTTTATCAGAAGATGAATAAGTTATCTGTTCTCTCTCTATGCATTCGCGATGACACGGGCGGTGTGCTTTTTATTCGAG ATGTGCAAGGTGCCATCGGTGCTTCCACACCCTTAGAGGCGGAGGAATTGCTTATTGAAATGATGTCTGATGGGTTGTTG CATGGGCGCATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1831865: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318653411399AI077091TENU3238T. cruzi epimastigote normalized cDNA Library


Date: 13:24:0 on Thu 23 Nov 117.