EST 1831871 is a singleton


Sequence

>1831871 (1 EST) Length=556 TACCTTTTTGCCTGCAGGCTGCAGTATTTGGGTAGTTTTGTCTGTTTCACTTTGTTGGGATGGCGCAACAAATGCGACCG GGGGGTAAAAGCTGTCACACCGTCTCTTCCCACTTCCACGAGGGCGAGTTGGCTCGGATGAAGCACACACACGAGCTGGT GCGGTGTGATGCTGGGCCTCGTCGCACCACAGTTCCGAGCACCGTTGGCGGCACCAGTGAACTCCCGTTGTCGAGGCGAA TCAATCTTCCATTATATCTGCGACCGCGCAATAATCTTGAAACTCTCTCTCGTTTCAGGGCAGGCCCCGTGAATGATTGG AAGAATTCTCTCCGACGCGAAACGGTGGCACTTCCGGTTTTGCACCACCGCTTTATTCGGGAACAAAACAACGCAAGCAA CATAAATCGTGTGAAATTTGCCGTTTCTGCATATGAGGACGGTTCCAGTGGGAAGAAAAATATCGATTTGGACGTGGCCG AGCCCACGGTGTACCAAGAGGGTCATGAGGAACCCGGGTGGGCAGGGAAAGGAGAACAATCATTGGAAGATCATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1831871: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318713411405AI077097TENU3244T. cruzi epimastigote normalized cDNA Library


Date: 21:20:13 on Fri 24 Nov 117.