EST 1831873 is a singleton


Sequence

>1831873 (1 EST) Length=524 CTGTGTGTGAGCATGTCATCGAAGCGTCAGTTGTTGAAGATCATTATTCTTGGCGACAGTGGGGTCGGTAAGACGTCGCT TATGCATCAGTATGTGAATAAAAAATTTGACAGCCGTTACAAGGCCACCATTGGTGCCGACTTTCTTACGAAGGACTTGG AGTTGAACGGGCAATTGGTGACGCTGCAGATTTGGGACACTGCCGGCCAGGAACGGTTCCAGTCGCTCGGCTCCGCATTT TATCGCGGCGCGGATGCCTGCATCCTCGTCTTTGATGTCACACAACAGGAGTCCTTCTCCCACATAAGCTCCTGGTTGGA GGAGTTCAACATTCAGGCGGGTAAGAGGGACAGCGTGCTGATTGGCAACAAGACAGACCTTGCGGATCGTCGGCAGGTGG CAAGCAAGACGGCACAGGCGTGGTGTGCGGCGCAGAGTGGAGAAACTGCTGCTACTTCCGGCGGTAGTAGCATCACCGCC AGTGGCTCGGGGGGATGTTGCATGCGGTACTTTGAGACGTCCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1831873: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318733411407AI077099TENU3246T. cruzi epimastigote normalized cDNA Library


Date: 2:38:19 on Fri 24 Nov 117.