EST 1831880 is a singleton


Sequence

>1831880 (1 EST) Length=341 TCCTTTTCCCGCATTCCACTCCTTCTGTATCCATTCACTCTTATTCCGAAGAAATCGTTACATCCGCTGTGTAAAACCGC AGCTCCCTAATGTGCACAGTACCTCCATTTTCTTTCCCCCCACCACACAACTCCCCCATTCACATTGTCAATCGAAGGAG GAATGAACAAAGAGAGACAATACACGATTAATGCCTCACTGCTCTTTTTTGCTTTAAGAAGTTTAATCTCAGTGTCCGCC CAGCGTTAACGCTCTCACACCTGCAGGGAATGGTCGTAAGGGAAAGAGGGGCAAACCGGGCAAAGCAAGAAAGGGAAAGA GAGAGTGTTTGGACGCCACGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1831880: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318803411414AI077106TENU3253T. cruzi epimastigote normalized cDNA Library


Date: 13:55:22 on Mon 20 Nov 117.