EST 1831881 is a singleton


Sequence

>1831881 (1 EST) Length=459 GGTCCGACTGTGTGTGGGATCCTTATCTGCCACGTCTTGTTTAGAGTGAGGACGGCGACTTTTAGTAATTTTTCCTTTTT TTTTTACGTTGGAAGCGTGTGGGAAGGATGTGTGGCCATGTGAGGAAGAACGAGCAAGAGGGTTTCTTGTCCACCTGACA TGCCTCTTTACCTGCAATGTGGTGCTGGTCTCCAAAGATACCAATTTGTAAGGCAGCAAGTGCAGCTTCTACTTTTTCCC CATTTCTGTTGCCCCACGCATTTCTTCCTTTTCCCCCTCCACGTGGAGGGGGAAAACAGGGGCTGCGGAAATCGTGAAAA CTGCCAGTTCGTGGGTTCACAACGAGCCCGGTTATCACGACAAATATATTTGGAATCGGTTTACTACTGTGTGAGTGTGG GTGCGGGTCAACTCGTTTTTNAAGCGGGGGATGCTGGGCGCATTGCACCAAACTGTCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1831881: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318813411415AI077107TENU3254T. cruzi epimastigote normalized cDNA Library


Date: 12:50:32 on Sat 18 Nov 117.