EST 1831888 is a singleton


Sequence

>1831888 (1 EST) Length=488 ACGTGAGGAGCGACAATTGCAGGAGGAACGCCGCAGAGTGCAGCTGCTGGAAGACGATGTTCGGGAGCACATTATTAATG GCGTCCTTGCGGAACAACGAGATTTAGTGAGGAAGAGCGAGGAGGAAAACGCCGCGCTACAGCAGCACCTTGCACAAAAA CTGGCGGAGGCGGAGACATGTGGCAAACGATTGCAGGAGCATGAGCAGCGGCACGAGTGATTCAACAGGAGCGCGTGGAG AGTGTACGGAGAACTATGCAGTTAGAGGAGGGAAAACTGAAACAGATGGAGAATGTGGACGCCACGCGTCTGGTGCTTAG CAAAGAGCGCGAGGAGCTTGCAGCGGTGCAGGCGGAGTTGAAAAAGAGAGAGGCCGTTGTAAATAATTTGAGAGAAACGA TTGCACGACTTTCACGGAAGCGAAGGCAGCGTGAATGAATGCGGGTCACAGTAGAACTGGCCGTACGCCAAGAGAGAGAG AGTGTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1831888: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318883411422AI077114TENU3261T. cruzi epimastigote normalized cDNA Library


Date: 1:39:48 on Sun 19 Nov 117.