EST 1831889 is a singleton


Sequence

>1831889 (1 EST) Length=359 GACTTCCACGCATGATGTGGACGCCAGTGCATCAAGGAATGAAGGCACGGTTGTCAAGCCCGCAAGAGGGGAGCAGTTCC TGTTATCCTCACTCAGCCAATTCGGGTCGATCTCTTTTTCGTCACCGAAACTTCCTTCTACGCGAACCCCCCTTCGTGCC TCATTGAACGTCCGTGCGGAGAAATGACATTTACTCCAGTGGCGAGAAGAGGAAGAAGAAGAAAAAATAAACTTGCATAC ATATCTATATACGTGCCTATATAAATATATCTATCATATATTTATCGTATTGTTTTTGAGGAGAAGAACGATCTCTGGTT TTCGGTCAGCCCGAGTGGTGCAATTCCGGCACGCATATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1831889: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318893411423AI077115TENU3263T. cruzi epimastigote normalized cDNA Library


Date: 0:37:22 on Fri 24 Nov 117.