EST 1831890 is a singleton


Sequence

>1831890 (1 EST) Length=244 TAGTTCTACCCCACCTTCTGGTACGGAAAATAAACCAGCTACAGGGGAAGCTCCATCTCAACCGGGGGCTTCTTCAGGTG AAGCAGAAGCCTCCTCAAATAAGAATGACGGCAGCCTCAGCAGCTCTGCGTGGGTGAGTGCCCCGCTGGCGCTCGCCGCA TCCGCGCTGGCGTACACCGCTCTGGGCTGAGGCGAGGCGCGACTCATGAGTGTCAGCACTCAGCCGCGTGGACATGTGCG CGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1831890: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318903411424AI077116TENU3264T. cruzi epimastigote normalized cDNA Library


Date: 4:16:20 on Wed 22 Nov 117.