EST 1831894 is a singleton


Sequence

>1831894 (1 EST) Length=482 TGATTCGAATTAGTGACAAAATTCCGCGAGCTGTGGATTTGTGATTTTTTATTGTAATGTGTGATGAATCAGTTTGAGTT ATTTGTGGCAAGTTCAGAGAGTGCGAGATCTGATGCCTGGCGTTACCTTCGACGTCTTAGAGAGTTGGACAACAGAATCG ATGAGAACATGCAGCGTCTCCGCGAGATAGCAGAGACTGTGGTGAAACCCACCGTTACGCAAAGAACTGAAGAAAGAAAG AGGAAGAATGGCTTACCGCACGGGAATGAGAAACGAGGGCGCTCACCTCCAGGAACTGTGACGAGTGGAGCTTTTTTTAG GGGGCATGGTGAGGATGAGGATGACGTGTCCTCGGAAACCTCTGTTGTGTTATTAGAGCCGAGTGAGGCCAAGCTACGTG TGGAGTATCGCGCTTGTCGGCATCGCGTTTTGAGGTATGCGTTGGAACGGGAGGCAGTGGCGGAGGAACTTAAGGCGTGT GG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1831894: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18318943411428AI077120TENU3268T. cruzi epimastigote normalized cDNA Library


Date: 4:12:22 on Wed 22 Nov 117.