EST 1831908 is a singleton


Sequence

>1831908 (1 EST) Length=326 ATGTAAATACCCGTCTGCACCTCCCACAGTAGAGGCAGGGGTCGAGTCAACCACCCACAGAAATACACTCAATCAATCAC TCACGGAAACAAACAAACAAACAAACAAAAAAAAGGGCAGTGAGTGAGTGATTGAGTGATCCCCTCCCTACTGCGCAGTG GAATGGACGCAAACGAAGTTTCACACCCCCAAAGACCACGAGACTGCAAAAAGAGAAAAAGTAAAAAAAAAAAGAAAAGA GAAAAAAAAACCCAACAAAACCACCCTAAGAAACATGAGCATGCGTGTAGGTCTTGGTGTATGCATAGGGATGCGTACAT ATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1831908: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319083411442AI077134TENU3282T. cruzi epimastigote normalized cDNA Library


Date: 12:28:43 on Fri 17 Nov 117.