EST 1831913 is a singleton


Sequence

>1831913 (1 EST) Length=478 TGTCTACGCCTGCTGCCCCTTCTCCCCCCCTACCCGCCCGGGGCTTCCCTGCACGGAAATTCGCTCCTTGACTCTTTTTT TGTTGGTTTTGCTTTTTTTTGTGTGTGTGTGCCGCACTTTTCTCTCTTTATTCATGTCGTTGGTGTGGCGGCGGTGGTGT GGCATGAGTACAAACCGCGATGTATGAACACGTGTAACAGGCGCGTTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTCTAA GTGCCGCTGCACAATTCACCGTGCACGGCGAGTGTCCATTGCGCATGCTTCCGGAGGTGTGTGGGCCAGCAAGCGAGTGG GGTCGTGGGGCGGTGGGGATGGGCAGCAGGACGGCTCAACAACACAAGCCGCACACGGAGTAGAGATGGATGGATGGCGA GATGAAGAGGAGGTTAAAAAACAACAACAATAAAAAACAAACAAACAAGAGTTATTGATGTATTTTCTTCTCTCACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1831913: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319133411447AI077139TENU3287T. cruzi epimastigote normalized cDNA Library


Date: 12:13:28 on Fri 17 Nov 117.