EST 1831914 is a singleton


Sequence

>1831914 (1 EST) Length=467 CTCAACGACACTGCACGAGAGTGAGGCGACAGGAAAAGCCAACAAACGAAAGGTGTCGATAACTTACACGGATGGGAATC ATGAATATGCATAAATGTTGAAACTCATAATGCAGTCTTGAGTATCAATTTTTAGTGAAACATGTTTATTTCTTTAATGC CATGTGTACGACCGTCACTGGAACCAAAAGAATTAACGTAACGATGCTTATTTATTCGCCTTTTTCGGCCACGACTTTTC GGACACACGAAATTAAACTCACGCAAATTGACGTCTTTTTAACGTGTTTTTTAAACGGGATGGAGCTGCTGGCGTTTTTT TTTTTTTTCTTTTTTTTTTTTTAGTTGTCATTTTTTGCCGCTTTTCTCCCCCCACCACCCCTCCCACATTTTGATGTCCA CGCGGTTCTCATGGGCCTCACGTAATAAATTCTTTTCTGCCTGGAGCGGGGGTCATGCACGGTGAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1831914: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319143411448AI077140TENU3360T. cruzi epimastigote normalized cDNA Library


Date: 8:13:11 on Wed 22 Nov 117.