EST 1831923 is a singleton


Sequence

>1831923 (1 EST) Length=556 CCAGGGGAGAAGGGAGGAGAGAACAAAAGGAAACGTTGAAGACCAGCACAAATTTATTTATGCCTAAATCTGCGAGATGC ACAGGTAGACACACATTCTTTGGGAATTTCTCTATTTAACTGTTTATTTCGGCCGTCTTGTTATTTTGCGCTGCGTCAGT TAACCCTCATGCGTATTTTTGGTTTTTGTTTTTGTACCTTCGGCCTTTAATTTTTCCATTTCAATTCACGCATTCACAGA CGCGCGCGTGCACACTTTTTTGCTCGCTCTACCTTCTCCTTCTTTTTGTTGTTTTTTACGAAGTGTGGGTGACCCCTGCT TTGTTTTTTTCTTTCTGCTCTCTCTCTCTCTCTCCTTCTCAGTGTCTCTCTCTCTGTGTGTGGGTGTGTGTGATGTGGAT CGGTTTGGCTACACGGAAGGCGACACGGCGAAGGAGGGAAGAAAAGAACATGGAGGCAAGAAATAAAGGCCTTTTGTGCC GAAACAGGGACCGTGACGGAAAGAAGAAGGAACCGTGAAAAGAACAAAAAGGAAAGAGCAAAACGTGCTGGCTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1831923: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319233411457AI077149TENU3371T. cruzi epimastigote normalized cDNA Library


Date: 2:6:50 on Sat 18 Nov 117.