EST 1831932 is a singleton


Sequence

>1831932 (1 EST) Length=516 GGACGCCATTGACGTGACGACGTACGCGGACGACAGGGCCCTCGGCAAGTCGCACCGTCGTTGGAGAAACTCGTGCCCAT CCGCGGCGCGAAGGTGGCAATTGAGGGCGGCAAGGTGTATGTTCTGTACTTCTTCAACACCTTCTACCGCGGCGCCGACC CCGTCAACGAGGAGCTGACGGTCCTCTCGGAGAAGTACGGCGACAGGGTGGTTTTTGTTGCGATCAGCAACGACGCGGAC AGGGAAAAGACGGAGAAGTACCTCAACAAAACCATCGTGGACGAGAACACGAAGAAGCCGCTGCGTCTTGCACCGCCGCA CATTCTCTTTGACGAAAAGAAGGCAACCGGCAAGACGTACGCGGAGGCGTCCAATCTTACCGTCATGTCGTGCCCAATGG CATTCATTGTGGGGGGCGACGGCAAAATCGCGTGGCCGCAGAGTTCCTGCAGACATTCACCATCTCGCAGTCGAACTTTG AGGCACAGCTCAACCACGTGCTGGCGGGCGAGGCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1831932: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319323411466AI077158TENU3380T. cruzi epimastigote normalized cDNA Library


Date: 13:29:35 on Fri 24 Nov 117.