EST 1831935 is a singleton


Sequence

>1831935 (1 EST) Length=530 TCCTTTTACCAGAAATCAATCCACCCCCTTTCTTTCCCCAATTTGTTTTCCTATTTCCTCGTCTATTCCTCACCTCCGGA GAGATTCCTCTCCTCTGGCGTCTCCGGATAATATTGACACTTGGTACTGGCGCACCTTTTCCTTCCAGAACGCCGCTATT CTCTGGTCTTCCTCCTCGTTCACGTTATCGGTATTGACAACATCACATCTCTGCCAGTCACTTATCGGCGTGCCGCACAC AAATCATCTCCCACGACATGTCTCGGGATAATTCCTCCCAACTATTAAAATATGCCGCCAGACACTCAGTGAACTGCCTC ACAGTGCTGGGTGTGGTGTGGTGCCCACCCGCCGTAGTCATCCGCAGCCAAACCAGCGTCATTGGATTTGACTTCATGAA GAAAAAGCGTCCACCAACCGAAAGTTTTCCATCTCCGTTACGTACAGCACCCCGCACTCCACATCAATCTTCTCGTAACG GTATTCCATCAACGGTAAAAAATAGTGCCTGGTGGGGCCCTCCTGTGAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1831935: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319353411469AI077161TENU3383T. cruzi epimastigote normalized cDNA Library


Date: 11:49:24 on Wed 22 Nov 117.