EST 1831943 is a singleton


Sequence

>1831943 (1 EST) Length=331 ATGGTCGCCTTGTGGAGTCCGTTTTGCATCTGGGGGTGCTGACAATGTTGTGCACCTGTGGGACGCACGATATTTGTCAC GCGTACGCAGAGGCACCGTGCATCTTGGTAGGACACGAGGACGTCGTTACGTCCGTGTCGTTTTGTGCCAACCCTGTCTT TTCTGTTCTTCCCTCCGCCGTTATTTCGACATCGCTGGATGGCAGCGTCCGACTGTTGGACACATACACCGCGGGTGTGT GTCTGCATGTGCTCCATGGCCCCTTCCCCGTGCGAGCGCAATGCCGTCCAGCTGGTGGTACGGGGAGTGCAGTGCTGACC GTAGCGCATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1831943: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319433411477AI077169TENU3391T. cruzi epimastigote normalized cDNA Library


Date: 18:28:11 on Sat 18 Nov 117.