EST 1831947 is a singleton


Sequence

>1831947 (1 EST) Length=583 CTTGCCGCTATAGTTCCCTTTGAAGACGTTACAGATGTGGATGAGTTAATGGAGCAGTATAATGAAAATGCATTAACACT TTCTTTTATTTGTTCAGCAGCTCACATGCACCACGGCATTTATGTGCTTTTTGATGCGGGTGTCGCACAGAAGAAGGGAT ATGCCGGAAGTGGTGTATTTGTGAACATCAATTGTTGTAGGGATCGATCGGTGCCAACCACGTGCCCATGGGAACGCGAC ACGGTGTGCATCCCTTTTACCGTACAAACTGTTTACGGGCGTCTTTTGGGTTCGTTCTCCTCGCAGCTTAAGCCAGAGGT GTTTAACGTCATGCTGTTGTTGCTAAGCAGTCGCTTTGTCTACGAGGAAATCCATGAGGACGCGGAGTCAGTTACGTTTG AGGTGGCCCAAAGCGGTAGTTGTGTGTACATCAACAGCGATAGGATAACCGCATTGCAGTTGCTACAGCTTCGACGGTTG ATGTGTGCCAGACTGTGCGTGCTGCATTTTCTTATGCAACATGAGGCGGCACCCAGCGATAATGACGCGATAGCAGAGCA TTTGCTGAGGACGGGGAGTGACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1831947: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319473411481AI077173TENU3395T. cruzi epimastigote normalized cDNA Library


Date: 14:57:42 on Sun 19 Nov 117.