EST 1831948 is a singleton


Sequence

>1831948 (1 EST) Length=581 ATTGCAGTGAAATGCTGTCATTATGGAGCCATATCAGCAATCTGGAGAGGTTTGTGCAAACACAAACAAACAAAAAACAG CTAAGGAGCCTAATATGTCTGAAAATATGCATGGCCGAGGTTCATCTGTCAGGAAAATGCATGGGTTCTTGCCGGTAATG AGAAACACAGTGTAGTTACATGAAGCAAATGCCGAGTATCTGTCAGGCTATGGAACTTTTCTTGAACTGTGAGGCCCTTA TTCTGCTGCGTTCTTAACATGCACCCTTAATTGAGAAAACTTAGCGGCTGGCATTGGTAGGCAAAGATAAATAGATTGTA AAAGGCTATTTGCTGGCACGGGAGTTATTTTTTAAAAGGGTCAGCTTTTTGCAAAAAAAGACAAAAAAGGGATATCAGCG CCCACACCGGTCCGGCAAATGATTTTAATAGAAATTATCACAGGGGTCTAAGAAACGAATTGGCATTTCTCATCGGCAAA GGGAGCTTGACCTTCTTTTCCGAGTTTGCATTTTAATGGCAATTTTATTTTATGCTGAGGACGAAGAGCATGATGTTATA ATAATCAATAAAATATGGGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1831948: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319483411482AI077174TENU3396T. cruzi epimastigote normalized cDNA Library


Date: 23:35:57 on Sun 19 Nov 117.