EST 1831957 is a singleton


Sequence

>1831957 (1 EST) Length=288 TTTCGAGCAAAAGAGCTTCACTACAAGCAAACAAGCAAAGGCATGTGCACACGTACAGAGACATGCACACTCCAAGTAAA TCTCGCACGGGTCCCATTGGCCCCTTTCCCCAACCCCACTTTCAACGATACTGGAGCACGCTGGCTATTCGGTTCTTCTC AATCTTGCCCATGCTTCCAGATACTTTTGTTTTTCCTGTCGTCGTCGTCTTCGTCGTCACTAGAGGAGCCATAAAGTTTG GATTTCNCCACCGCTGCCTGCGTAGACGGCAGGAAAACACGGGCAGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1831957: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319573411491AI077183TENU3405T. cruzi epimastigote normalized cDNA Library


Date: 23:9:1 on Fri 24 Nov 117.