EST 1831959 is a singleton


Sequence

>1831959 (1 EST) Length=390 TCTCCACATCCCAATGACGAAGGCGAGGCTCACCAACCCCAAGTTCCAGATTGCCGCACAGAACGCGATCACAAGGTCGG GCGCTTTCACGGGGGAAGTCTCTCTGCAGATCCTCAAGGACTATGGAATCAACTGGGTTGTGTTGGGCCACTCGGAACGG CGTTTGTACTACGGCGAAACGAACGAAATCGTTGCGGAAAAGGTGGCGCAGGCCTGCCTTCCGGCTTCCATGTCATCGTC TGCGTTGGCGAAACCAACGAGGAGCGGGAGGCTGGCCGCACGGCAGCCGTCGTGTTGACGCAGCTCGCCGCCGTCGCGCA GAAGCTTAGTAAAGAGGCGTGGTCTCACGTCGTTATTGCCTACGAGCCCGTGTGGCGAATCGGCACCGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1831959: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319593411493AI077185TENU3407T. cruzi epimastigote normalized cDNA Library


Date: 1:34:49 on Sat 18 Nov 117.