EST 1831968 is a singleton


Sequence

>1831968 (1 EST) Length=573 GGTGGAGAATCTGGTGAAGCGCGATTGCCGAGGTGCTTGGTAGCATCAACGGCTCCCTCACTTCTCTCGTGAAGGAAAAT GCCTCATTGCAGAAAGAGTTGAATTCCATAATGTCTAGTGGGGTGTTGGATGAAATGCGTCGTATGCGGGAAGAGCTGTG CACATTGCGAGAGTCCGTTGCGAACGAGAAGGCAACAATGCCAGATTCTTCTCTTCACGCCACGAGCTCCTTTCAAGGAA GAAGGTCTGCGCCCGAGACAATTCTTGCAACCGCGTTATCGATGGTGCGAGAGCAGCAATACCGTCAGGACTGGAATACA TCTTGATGGCTCAGCAGCCCTCTCTCCTCCTGCGGTTCCTCAGCATACTTACAAGGGAAAACGAAAGCGCCTACTCGGAA CTTATTGAAAATGTAGAGGCGCCGAATGACGTGTGGTGTTCAGTTCTGTTGCAACTCATAGAGGCCGCGGCGACGGAGGC TGAGAAGGAGGTGGTTGTTGGCGTCGCATTGATATTCTCTCCGAGCGCGATCAACTTGCTCAGAACGGCGCACTCGGCTC GAAACTCACCACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1831968: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319683411502AI077194TENU3416T. cruzi epimastigote normalized cDNA Library


Date: 0:12:16 on Sun 19 Nov 117.