EST 1831977 is a singleton


Sequence

>1831977 (1 EST) Length=338 GGCCGTCATGCGTGCACAGACGTCATCGGCATCTTTGTGCCCACAGAGCTTGCTGATGCTGCGAGGAGGTGCAGGCGACC TCTCATCATTGGACTGCTGGGGCTCTTTTCCTCTCTGCTCAGCGGGAGGAGCAGCTCTTCTTGCACGTGGTGTGCTGTTC TGCATCAATAATCCACACGTGTTGTCGCGCCGCCGTGCCGTTGCAGTGCAGCTCTCGTGCTTCTCACTGCACGCGTGGCT CCATGTCGCTTGGCTTATTTGCAGGGCCATGGCCTGTGGTCCCCCATTGGGAGGCCAATCACATGTTTTTTGTGTGTGTG CTGTTAAGAGGCACTAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1831977: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319773411511AI077203TENU3426T. cruzi epimastigote normalized cDNA Library


Date: 14:18:37 on Mon 20 Nov 117.