EST 1831983 is a singleton


Sequence

>1831983 (1 EST) Length=327 GGGGAAAATCAACAAAAAGGAATGGGTGCATTGACACGCCATGCTTGAGAGAAAAGCCTGCAGCCAGGCCGAGGGCATTG CCAGGGCCGTGTTGAGTTCTGTCTCCCAGTCCGCACATTGCTCCGTCTTCATGCGTGGTGGTCATCCATGCACACAAGTC GAGCATTAAGTGTGAAAAGGGGGGCTGAGATGCGGAGGGGTTTTGGTGCGAGCACATGCTGCGCCGACGGAAGTAAATTA AACGCCAATTGATGTGCGTGTGTGTGTATGCGTGCGGGAGGCGATGCGGAACTGCAGGCTTCGTGCAATCACGTTTCATG GGTCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1831983: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319833411517AI077209TENU3432T. cruzi epimastigote normalized cDNA Library


Date: 7:21:50 on Sun 19 Nov 117.