EST 1831985 is a singleton


Sequence

>1831985 (1 EST) Length=517 GGGTAAGTTTATTGTAGGAATAAGTGGCTTGTGCATTGTAATAGAAGGGCAATAAGGAATAAGTGGCATATTGTCCTGCG TATATATATATATACATATATATGCGTATGCTATAGAGTGGAGCACTGAACATCGTCGCTATTCTGTTTTTAATAAACCT TTTTTTTCTTTTTTGCCGTAACAGGCCTTGTAACCAGGAGAGGACTGAAAAACGGGATGTGTTGTGTTTTTGTTGCGGCT TCCCGAGCATCTCCTATTTTGTAGCATCAGTCACACGACACTGGCGCTGTGTGGGCAACCGTGTTTACACGTTGTCGTCT GCGGTGCATTGTGAGTGTGGGGGGTGGGTGTGTTCTTTTTTTTTTATTTAATAAAGATTGTTTCTGCGAAGGGGCAGCGG GGACACCGCACGACGACCGCTCCTTGTTGCTTCGCAGGAGAATCGAGATATTAGGGAATAAAACAATTTTCCTCACAGTG CTGAACTCGCTCTGAGGGTTTATCGGGAGGCTGCGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1831985: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319853411519AI077211TENU3434T. cruzi epimastigote normalized cDNA Library


Date: 5:4:0 on Sat 18 Nov 117.