EST 1831987 is a singleton


Sequence

>1831987 (1 EST) Length=444 TGGAGAAGTGGGGAAGTCGTGCTCCACGGAAATATTGGTGTGTCTCCACTTTGAAGTGGAAAGGTCTCTGCCCCAGCAGT ACCTCCGCGCGGCGAGAAGGCATGAGGCCCCTCGCAGATGCGGCAGGCCGTATTTGCTCCTGGCAGGCTGCCCTCTTCTC CCTTTCCTCATTTATAGCGTCCATGCTTGGTTGGTTCTGTGATTTGTTGTTTTATTGATTATTGGCGGCAACGGATTATC GAGCCACCGCGCTATTCCCGGGGCGGGTGCGTAGCGGTGGTGTGTGCTTCACGGCCTCCGCTGCGGCTCCCACTTCTGGT GCCGGGCTCTCTTTTAAATCTCTGATCGTTGGGCGGACGTGGTTTGCGATGGTGGCTGGCGTGTGGGCCTTCGTATTTAT TTTAGAAGACACGAGGAATAGTAACAGTACATATATATATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1831987: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319873411521AI077213TENU3436T. cruzi epimastigote normalized cDNA Library


Date: 12:39:15 on Tue 21 Nov 117.