EST 1831989 is a singleton


Sequence

>1831989 (1 EST) Length=570 GGGTTATGAAGGCTTTGCAGAAGAAGATGGGAGCTCGCCCCGCCGTGAACGACTTAGATTTGACGGGTTTTGAGATCCAG CCTTTAAATGTCATTGTCGGAACGGCAGTGTTTGTCCTCAGCGTCATTCTGCTTCACTTCTACGGTAAGCTGGGCGGCGC AAAGCCATAAAAGTGATGGAACGAGACGGCATGAACACTGAGATTATGTATCAAGATCCTCAAGATGGACAGAGATTTAG TAATAGTGCTAGTAGGAGGTTTGTGTGTGTGTAACTGTGTGATGTGGAGTTCTGAATGAGATAGACCTTTTGTGCATGGG TGAATGGTGGAAAAAGTGGTCGTGACTGTAATGTGGTTGCGTGCCCTTTTTTTTTTTTTTTCCTCCTATTTACTTTTTTG TCTTCTCACTGCAGAAGCTCTTACTCTTTCTTTTTTTTTTTCTTTTTTCCTTTATATACCTTTTGTTCTGCACCGAATGG AAGAAAGAAAAGGGTGCAAAGAAATAATTTATAACACTCATACACTGTACGGAAATATATCCGCACCTGCACCGAGACCG ACACTCACGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1831989: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319893411523AI077215TENU3438T. cruzi epimastigote normalized cDNA Library


Date: 11:21:12 on Sun 19 Nov 117.