EST 1831994 is a singleton


Sequence

>1831994 (1 EST) Length=466 GGTGGCGAGCTGGCAAAAATTCTCAGGGTTGCGTGGATGGAGAGACTTCGATTAACTTTTCCGTGTTTTTGAATGAAGCT CTCTGTCACGCCAACATGCGTCTTGCCCATTGCACGGAGAACGACGAGGAGGCCTTGTGTGAGGCGCTTGCAAGCCGGTA CAAGGCAAGTCTCTGCTGCGCCCTGAACATGGAGCTGATCCTGTCGGTGGTGATGGAGCTTCGCTGCAAGCTCACGGAGA CGGAGAGGGTATTCTTAGTTGCACGCACCATACACGGCCTCTTGTCGGCCACGGGTGAAGATGTGGGCGTCTCACCGCGC AGGGCACTCGACACCGCGAGTCAATGCTCTCTCACGAGGCGGTGCGGCTGAACACGCCGCGCTTGGGAGTTTTCTTCATG ACGTGTTATTCATCTTTGACTCTGTGCTAAAGACACCAACCCGTCCGTCAGTAGAGCAGCTTGGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1831994: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319943411528AI077220TENU3443T. cruzi epimastigote normalized cDNA Library


Date: 19:21:6 on Thu 23 Nov 117.