EST 1831997 is a singleton


Sequence

>1831997 (1 EST) Length=590 CATGGGGCAGGTTGTGGGGCTGAGTTTCAGCAAGGAGGCGGGGCCAGAAATTGAGGGCGACACTGCGGAGTGGCTTGGAA GCATGATGGCCCGCCCTGAAGCGGAGTGCGGCCTGCGCATACTCGGCGACGATTGCTGCTAACCCTTCAAGCAGAGGCTT CACCTCCGCCCTAATTCTCGCACTGCGACAAACAACAACAACAACAACAAGAGGGAAAGCAGAAGAAAGCAACAGCCAAA AATTAATGGAGGATGCCGACTGTTTATTCATGAATGTCTGAAGGGATTACGGAGTCGCTGGACGGTTTCTCTCTTTTTTT TTTATTGTTTGTATGCAGCACTTGTGCACATTTATTTGTTATTATTATTATTATTATTATTATTACNAGTTTTTTCACTG CTGCAAGAGGTGTTTTTAAAGAGCTTCGTTTGTGTGCGTGTGTGCGTGTGTATACATTTGCCAGGGAGGTCAGTGCCATT TTTTTTCTTCTCATTTTTGCCCTTTGGTGCGTGCCTTCTTTACTCCCCCCTTTTTAGGAAGGTCAATGGGGATGGAAACA ATGTGCGAGAGGACATGAGACCAAGTACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1831997: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319973411531AI077223TENU3446T. cruzi epimastigote normalized cDNA Library


Date: 14:26:43 on Fri 17 Nov 117.