EST 1831998 is a singleton


Sequence

>1831998 (1 EST) Length=375 CATGGCGGCGGGTGGTAAAACACCGCAGCGGTTTACTGACGTCATCTTGGCGACGCGCAACGAAGGTGGTGACGGCACGA GTTCCCTGATGAACCGCGAGTTACGCGTGACGAAGTCGGTCCAGTCACTCCTGAACCCTGCCACTGTGGCTGAAGTGAAG CCGATGTGATTGGCGTCCGTATTTGATAAACATTTTTTTCCTGCCAACGATGATTTGATTCTTACCATCATGCACAAATA TAAGGAAGCAGGCATATATATATCAACAAATAAATACATGAATACATAAATATCAATATAAAAATACGTCCAGTGGTAGC CATGCATGGGGAGAAAATGAGGGGAAAGACACGTTTAAAACTTTATAATAATAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1831998: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18319983411532AI077224TENU3447T. cruzi epimastigote normalized cDNA Library


Date: 19:48:53 on Fri 17 Nov 117.