EST 1832000 is a singleton


Sequence

>1832000 (1 EST) Length=393 GATGGTGGAAAGTCCACATCGGAAACAAGGGTCGAAAATGAGCACAGATACACAAACATACACACACGTGCAGTCATGGA GACCACAAGGGTCCTTCCACGCCTTTATTTTCTAACCCTTTCTTCCAACCTCTGTTTTTTTTTTTTTTAATTTCAGTCGC TTTTCTTATTTTCCACTGCTCTTATCATTTCACATCCCCCTTTTTTTTTCTCTCTCTTTTTTTTTTTTTTTCGTACATTC TTCCCATTTATTTCTCTTCTTCTTTTCCATCGACGCACTTCCGTCTTTTGGTTCCTCAAATCATTCATTCATTCATTTCA TTTTTTTCTGTTCTTGATTGCAGCGTTTGTCCCCTGCCCTATGCCAACAGCAGGAACCCTTTAAAAAAAATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1832000: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18320003411534AI077226TENU3450T. cruzi epimastigote normalized cDNA Library


Date: 15:28:33 on Fri 24 Nov 117.