EST 1832001 is a singleton


Sequence

>1832001 (1 EST) Length=558 CAGGATGGTAGGAATGGCGAGGAGCGGTACCGTTGTTCAAGGATTTTCTTTTTAGGCTGCTGATGTACAACCCGAAGAGC GCATGACGGCGAAGGAGGCACTGGCGCATCCGTGGCTACGAGAGGTGCGGGCAAACTGCGGCGGGGAGGAGTTTGAGACG GAGGCAGGGGAGCAGTTCTTTTGGGAATTTGACAGTACCGAGCTGAGTGCTGTCCAGCTGCGACACTGCTGATGAACGAG ATAATAAAGTACAATGAGTGACAGCTGAGGGCAGTTTGTAAAAAGGAAAAAAAGAAAAACGCCACCCTTACCAAAGAGGG AGCAAAATGAAAAAGATACACATGCACTCACACACAAACACACGGAGACGAAATTACACAGAAATCAAGAGTACATTTGT TTCTTTTTGGCTTCTTTCTGGGTGCTTTTGCCGTATCTTCGTTTCATGGCGGATTTCCTTGTTGTTGGATGGATTCCTCG TGCGCGTTGACTCGCAGCGTTTTTTTTTTTTTTCTTTTTTCTCTGCCTGTTTTTGGGCTGCGCTGACCGATGGGAGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1832001: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18320013411535AI077227TENU3451T. cruzi epimastigote normalized cDNA Library


Date: 16:31:53 on Sun 19 Nov 117.