EST 1832008 is a singleton


Sequence

>1832008 (1 EST) Length=579 TGGCGTACCACCGGCGCGAGAAGCATGCGCCGTATCTCACACTTTTTGTGGGTGGCAACCACGAGGGTTCTGACTGGCTG GCGACAGAGTGCTACGGTGGATTTCTCGCGCCGAACATCTACTATATAGGACACTCCGGTGCTGTGATTGTGGATGATTG TGTTACTGTCGCTGGATTGAGCGGCATCTTCAAGGGACACGACTACGCGCGGCCGTATCCGGGCCGTCCATTCCATGCGT CGGAGGCGGCGAACGCTCCGCCTATCACGTACGGCGCATTGAGGTGGAGAAGCTCAGGGCGTTCTCGCAGGCGTTGGAAC GCATGCGGCACCAGCGAGTTCTCCGGTGACTGCATCCATGGCAGGGCCTAGCGCGTCACCCTCGCGATGCGCTGGGGAAT TTCCACACATTGATCTGTTTCTCTCCCATGACTGGCCAGCGGGGATCACAAAGTACGGGGATGAGACGCAGCTGCTGCGC TACAAGCCTTTCTTTGAAGAAGATATTCGGCACGGTGCGCTGGGAAACCCGCATACGATGACGTTGCTTCGCGCTGTCAA GCCTCGGTACTGGCTGGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1832008: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18320083411542AI077234TENU3459T. cruzi epimastigote normalized cDNA Library


Date: 22:4:45 on Fri 17 Nov 117.