EST 1832010 is a singleton


Sequence

>1832010 (1 EST) Length=308 CTTGTTGATGGGCGTTTTGCATCCGTACTGAACCTTGGCGACTGCGGCACGATATGTCTGCGGACGTCCAAGCTATTCTT TGCCACCGAGGCGCACGAGCACAGGTTTAACTGCCCATACCAACTCCCGGAGATCCGCCTTCTGCCGGGGACCGTACAAC TCTTGAAGTGAGCGAGGGCGACGTGTTCCTTTGTGCGAGTGACGGCTTGCTAGACAATGTCGAAATGTCAGATATCCTGC GGCGTTTAGAGAACGTTGAGCGTGAAGGCTGCCAGCGTGTTGCGGAGACTCTAGTTCAGGAGGCCTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1832010: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18320103411544AI077236TENU3461T. cruzi epimastigote normalized cDNA Library


Date: 3:54:13 on Sat 18 Nov 117.