EST 1833627 is a singleton


Sequence

>1833627 (1 EST) Length=301 GGCAGGTTCACTTTTTCTCTGCAGTGAAGAACAGGAAGTGGCCTACGAGCTCTTGAGGAAGTGTCTTTCACCTCAGGCCT GGGAACCGTATAGAACCTTTGGTCCGTACATGATTTACACCGCGGAGTTCCGTGCTCAAGTCGATTGATTGCTAAGCTGG TTATTCCCGCCGAAGATCAGGAATCGTATGATCTTTCTCAACATTTTCAGGAGGGTGTCTTTTGTTTTCTGCACGGCATC CCATTCTTTCCGTTCGACGCGGCACGTAGTGGACCTCAAAATGAGCCGTCCCTCCTGTCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1833627: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18336273415141AI078965TENU3586T. cruzi epimastigote normalized cDNA Library


Date: 21:32:58 on Fri 24 Nov 117.