EST 1833633 is a singleton


Sequence

>1833633 (1 EST) Length=332 AACCTCGGGGCGTTGTTTTTTTACCAGGTTGTATCTCGTTTCTACAGCGGGCAGTCCATGAGCGTCGCGTACTCCTTTGG AATGACAGTTGCCGTGGTACTTTCAGCGGCCGTGCGGCAGAGGTACAACAGATCATACCACATGTATTTACAGTCTTCTC AGCAATTAGCTTCCATGAGTGTTGTCTCTGTTGATACTCCCGAGTAAAAACGCACTTTTATTTTCTTCTCTGTATTTGTC TAGGCGTGTGTGTGTGTTTTCTTTTTGGCCCCATTTTAGAGAATGAAGAAGAAATTTGCGTGACGCCTTCCCTCCACCTC GGGGTATTTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1833633: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18336333415147AI078971TENU3592T. cruzi epimastigote normalized cDNA Library


Date: 14:17:14 on Mon 20 Nov 117.