EST 1833648 is a singleton


Sequence

>1833648 (1 EST) Length=279 AGTAAGACAGGGGNNTGTCATGGCTCTTTTTTGCCGCGCGAATTGCGGGGATTTTTCATAAAGCATGTAATTGCACTCCT TTCTGTTGTGTTGGAACTTGCCATGATGCATCGCTTCTGTGGCGTGTGTGATTTGGGTTGTCTGCGTGTGGCCGTGGCTG CACCGAATTCTCTTCCCACCTTTGTGTGTATGTTTTCGTTTTTCAGTGACGATATGCCCACGTCCTCTTGCAGAGTGTGT GCGGTGTCGGCGGTGCACAGGGGTGCGGGACCGTGGCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1833648: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18336483415162AI078986TENU3608T. cruzi epimastigote normalized cDNA Library


Date: 10:3:47 on Wed 22 Nov 117.