EST 1833651 is a singleton


Sequence

>1833651 (1 EST) Length=263 GGCACCGGCCGTGAAGCGCCAAACGATCGTCATTCCCTCCTGGAGAGGGGAATCGAGGGCATCTGGTGGCGCTGAGGTGA CAGAGCAAAGACCAAAATCACGCCAGCAACAGAGTTCAAAAAGAGTCCCATGCCTCAAATTCCTCCACTCGACTCATTCC GCCACGCCCATTCTTCTTTTCGCGCTCTCCCTCTTTCACCTGCTCCTATTCTCCTGGCAGCATCAGTTGCTGTCGTTGGT TGGCGCCGCTCACCGGGAGCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1833651: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18336513415165AI078989TENU3611T. cruzi epimastigote normalized cDNA Library


Date: 12:0:46 on Thu 23 Nov 117.