EST 1833661 is a singleton


Sequence

>1833661 (1 EST) Length=452 TCCAGATCCAAAATTTCAGAGCATGCGTATGTTTTACAAGTTGTCGAGAAACTCGGCAACGCAAGAGTTGCCTATGATCA TGTGCCACGCTGTGCGCAGGAAATCCCTGCACGCTACAGGCAACAATTGTCACAGTCACTGCCACCGCTAACGTCCGATA ATTCAACCTCTTTACGCAACTCTGAGTTGAGGGGTAAGAGCTCGCCTCGTAAGACGACATGCAACACGCCGACTGTGTTG AAAAGTGGCGTGCCGAGTCGTTCCTTTCCGACTAGCGGCGTGTCTCGCAACCAGATGGCCAGTAATGAACATGGTGGCGT TGACGCCCAAAGGACCTCTGAAGTGTTGGATAGGAAACCCTCATTGATTACAGCCGCTTCTCCTCCGGGCAGCCGCGATG TGTTGGCACAAGGGAAAAAGAAAAACTCTTTGGGCGCCATGAGTCTCTCATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1833661: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18336613415175AI078999TENU3621T. cruzi epimastigote normalized cDNA Library


Date: 21:23:7 on Fri 24 Nov 117.