EST 1833664 is a singleton


Sequence

>1833664 (1 EST) Length=468 GGCCGCTTCCAGCGTCCCCAGAAAGCGGAAATGTACCGCCACCAGCCACGGCTGCTGCTCATGTGTTCGTCTCCATGCGG TGTGGTGGTATTCTGCTCCACCTCCGTTGCTCTTTCGCCAGCACCTCGCGGTCTTTCATCACGTCCATTTGACGCTACTG TCATCTTTCCGTTCTCCTCCATGTTATTTATTATTTGCAGCTCCTTCACAAGGAAGAACCCGCAGCTTGGGCGTGTCACC ATAAAGTACCCTTTGCGGCGGTAGTAATTGCGCACCCCGACACCGCTGATGACGGCAATCCTCTTGTACCCCGCGGCACG TGCGATGCTCTCCGCCCGCTCCAGCAGCAACGACCCCACGCCACGGTGTTGCGCCTTCGCCGTGTCAGCCTCCTTGTGTG TTGGCACTAATCGCCCATAAACATGCAACTCGCGGATCAACGCACATGACCGCAGCTCGTCAAAGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1833664: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18336643415178AI078906TENU3624T. cruzi epimastigote normalized cDNA Library


Date: 19:56:14 on Fri 17 Nov 117.