EST 1833668 is a singleton


Sequence

>1833668 (1 EST) Length=504 CTATATTGAAAAAAGAAGCGAGAGAACGAATAAGAAAAGAAAAAAGAAAAAAAAAAAGATGGTTGCTGTGGCTGAAATTG AGGCGCGGATTCGCTCGAATTTGGAGCCCACTTCGTGTGAAGTGACGGCGATAAGTGAAGAAGACCGCAAGTACAGTGTG GCCATCGTGTCTCACATTTTTGAGGGCATGCCGCTTCTCAAGCGACACAGAATGGTCAATGATCTTTTCAAGGAGGAGCT TTTGTCAGGTGATATTCACGCGCTAACAATCGTTGCGAACCCCTCTTAATGATGATTGCGCTATCATCCACCTACGTCAC TTGTGGGGTTTGAGGCTTTGGCTTCTTTTCTTGTTTCCTTCGCACCCAACTTCCTGAGTTCTCCACGCATGGAATGTCGT TTTTGCTGTTTTGAGGCTGCTGTTGAGGAGGTGGGCCAGCGTAAGGCCTGCAGCTGCCGTGTTGGGATAGTCGTTTCCTT TTGTGCATAGGTGCCGCGTCGTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1833668: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18336683415182AI078910TENU3628T. cruzi epimastigote normalized cDNA Library


Date: 23:22:24 on Fri 17 Nov 117.