EST 1833680 is a singleton


Sequence

>1833680 (1 EST) Length=374 TGTTCAGCACGCCGCCGTCGTTTTTGGGAGTTTCCGCCACCACCGCGTTTCTGAGGCATCCCATCGTCAAATTTGACTCC TTCTATTTTTTAAGTGATGTGCCGGGGGAGTCCAACCGCATCTATGCGTCGGACAAGCGCGCACAGTTATTTCGCACACT ATTTAGCGTGCGCTGGTTTTCCGGGCCGTCAGTATTGTGGAGCATGTCCGAGTACGTCTTTCTTCTTGCCGTCTTCACCT GGCTGCGCGAGGTGCTGTCGTGGGGCAGTAACACTCCGAGGGGGTTTGCCGCCGGTAGTCTTACCGGAGTGGCGTATGCA GCGGTGCGGCACCCGTTACGACGTATTACGTGCAACGTCAGAGGCCACTGGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1833680: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18336803415194AI078922TENU3640T. cruzi epimastigote normalized cDNA Library


Date: 13:30:27 on Fri 24 Nov 117.