EST 1833684 is a singleton


Sequence

>1833684 (1 EST) Length=408 TACTTCTACTTCTTCAATTTCTTTACTTTTAAATGTCTTTTTTCACTGTAGTTCAGCCGGAGTAATAACTACTGTTGTTT TTTCTTTGCGTAATTTTAGGTTGCTGAACACTGTAATGAGCGAAGTGTTTCTCCCTCTTGTTTGTTTTTGTTTTTGACCA CACGCGTTGCCGGCCCTGCGGCTGTGCGTCCCACGGACTGCACGAAAGGAGGATTGGAGGAACAGGCCGGATGCCGCATG AAATGTGAAGAATGTTGTGTGGGATGCTGGAATAATGCGATCTTTTTTTATTATTACGTTTTTCGTTTGTGCAGGTAATA TGTGCAAGCACCCAATCGTCTTTAGCTGCATGGCACATGAAAGTCCTGCCGAATCATTTTTTTTTTTCCATGAGTCCTGC AGGGGTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1833684: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18336843415198AI078926TENU3644T. cruzi epimastigote normalized cDNA Library


Date: 7:22:25 on Sun 19 Nov 117.