EST 1833688 is a singleton


Sequence

>1833688 (1 EST) Length=411 TGACAATTCGTATTACGCACCCGCGGTAAAAACGGCCGTCTCGTCCATTGCCGCTGAAGTTGTGAGGAGAGAAGGGGGGC GGCATTAGCGGTAGAAGAAGCAATGACGTACTTCACGGTATATTACGGCAACAACGAGGCGATGATGTTCAACGCCGAGT GTAACACCGGCTCGCTGATGGGCCGCATGATTGAATTGCTCGCGCCGCACACCACCGGCTACACACGACTGGAACTTTTG CCAATGAACTTCGTGCTGGAGCACTTTAAGCCGTCCACCGGCATCTCCGTCACCACCGCCAACGACGTTGCCGCAGTGCC GCCAGCTTCGCACCGCAAAACGCTATTAAGTCCCCGCCGTTCACTGGAGCCATCCCTTTCGTTGGGCTCGCCACACGGGC CGTTGAAAGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1833688: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18336883415202AI078930TENU3648T. cruzi epimastigote normalized cDNA Library


Date: 12:36:40 on Tue 21 Nov 117.