EST 1833689 is a singleton


Sequence

>1833689 (1 EST) Length=378 TCTGTACTATATTGGATATAAAAGTGTGATGGGCTTCATGCGGCGCGTGCAAACTCACAAGAGAGCCGAAATACTCTTCC GCTGGTTCACCATTGGTGGCGTGACTGGCACCGCGATGCCGCGGGGGATGCAAGCCTTTCCTCTACGAGATAGTGCCGAG ACAATTGAGACGATTGCTGAGGCATACGTGAACATGGACCTGGCGACGATGCGGAAATTTCATGAGTCCGTTTTGAAGAA CACCACAAGGACGTGCGGTACATCTCGACTCTCCTATGAGCAGGCATTACTGCAAGGCATAGGAGCGGGAAACAGTTGGA GCAGCATGGGTACTGTTGGCGTTGGGGACTCGGCCCTCTCATCAACCAGCAGCCCCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1833689: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18336893415203AI078931TENU3649T. cruzi epimastigote normalized cDNA Library


Date: 18:54:21 on Sat 18 Nov 117.