EST 1833692 is a singleton


Sequence

>1833692 (1 EST) Length=406 GGCGTGCCAGACGCATCGCGAGCTCACGTTGCGTGGCGCCAACCCCGGCGGCTGCTGTTGCCAGCCAAGCAATGTTCCCA TGCGTTAGATCCATGGCTTCACTGCGGTGGCTGAATGCGCTTAGTCTGGTATCAATGTACTTTTTTTATTAGAGGATTTG TTTTTTAAAAACTGGAGGGGATGAGGAGGAAATGACTGAGAGAGCCGGTGCTTTTTAAATATTAAGGTGGCACCGGATGC TATTTTTTTTTATTTTTGTTATTATTATGTCTTTCGAAAAGGACGTCCGTTGTTGTGTTTGTAAGAAGGATGATGACGCC TCTTTGTGGACTCCCTTGTTTTCTCATCGATTATATAATGCTTCTTTTCAATGATACCGGGCGCTGGAATGCGGCGACTG CGGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1833692: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18336923415206AI078934TENU3652T. cruzi epimastigote normalized cDNA Library


Date: 11:41:51 on Wed 22 Nov 117.