EST 1833694 is a singleton


Sequence

>1833694 (1 EST) Length=416 ATTCGGACGAGGTCGACGAGTGCCATTTCCCTGCGGTCGGCGGATGTGCTAGGCGCATATTACTCGCCGTATCAGACCCC ACTCAGCCCTTCCTTTTCTTAGCGGGGACCGAGCCACGGCTATTCCCTTCCGTCCCTTTCCTCCTTTTCTTTCTTAGTGT ATGTTTGCATTTATTATCATTGTTTTTTCTTTTTTCTTCTTTTTCCCCTTCACGGAAGGGCCCTAGCGGAGTGCGGAAAC GACGGACGCACGCGGTGGGGATTGGAGGAGGAGGAGGTTTCAGTCATGTGAGAAGAATAAACAGAACGAAAAGCAGGTGC GGGGCGGGTGGGGAGGAGAAGTGTATTTATTTATCTTCCCACATAAAAACGCACGCACATACATGCATGCATTTATTGTA CGAAAATGCGGGTGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1833694: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18336943415208AI078936TENU3654T. cruzi epimastigote normalized cDNA Library


Date: 16:27:37 on Mon 20 Nov 117.