EST 1833695 is a singleton


Sequence

>1833695 (1 EST) Length=473 GCCATTCAGCCTACCGGCGGTCATCATCTGCGAGTGCATGCGGGCATTTGTCAGGAGGAGTCCGCGACAGTTCTAGGGGA TACGAGGGGTGTCACCAGCGGGGCGAAAGATCTGTGACACGATCGACGACGGTACAGAAGGTTGGGGAACGAACGGCCGA ATTGGGTGCTGCTGAGAAGGGGAGCCGATTGCTGGGGCGACGTGAAGCCATACCACGCCAAAAGCCGGAAAAATCTCCTG CAAGAGACCGGATTGCCCCGCGCGAGGTGCCCAAAGCACGTCATTCACAGGAACGATCCTCGAGTCCGGAAAGTGTGGAG GTGTCGAGTATCACCGAGGAAGCTGACAGCACGCCGGATATGAAACATCCGGGGGAGGTTGTGGCGGAGTTGGAAGCATT GATTGCCAAACCTTTTGAGAGTTCTCCTGCGGCTTCGCGATGGCATCAGGGATCCAACGTGCATGTGCTCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1833695: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18336953415209AI078937TENU3655T. cruzi epimastigote normalized cDNA Library


Date: 19:20:55 on Thu 23 Nov 117.